AnnoJ.DataTypes.Reads

• A 'read' is a short sequence read from deep sequencing
• Data structure for sending multiple series of reads
• Each series is differentiated by a name

Structure

		var AD = AnnoJ.DataTypes;
		
		AD.Reads = [
			AD.ReadSeries // array of data series
		];
		AD.ReadSeries = {
			label : AD.TinyText, // text label for the series
			reads : [
				AD.Read
			]
		};
		AD.Read = [
			0 : AD.TinyText,    // id
			1 : AD.Strand,      // strand
			2 : AD.PositiveInt, // start
			3 : AD.PositiveInt, // length
			4 : AD.PositiveInt, // copies
			5 : AD.PositiveInt, // locations
			6 : TinyText        // sequence
		];
	

Example

		var reads = [
			{
				label : "readsCls",
				reads : [
					["262843" , "-", 34055, 36, 1, 1, "ATAACAGGGTTGAACCGAGAGAAAGTGAAGGTAACT"],
					["934129" , "+", 34115, 36, 1, 1, "AAAGACAGAGCAAAATTCTGAGAACGTACAAGGTTG"],
					["538034" , "+", 34129, 36, 1, 1, "ATTCTGAGAACGTACAAGGTTGTGGCTAGTAATGAT"],
					["1192502", "+", 34139, 36, 1, 1, "CGTACAAGGTTGTGGCTAGTAATGATGAGGAAGAAC"],
					["728924" , "-", 34172, 36, 1, 1, "AACAAGACGTCGTGTTCTTAGGACCGAAAACTTTAA"],
					["1001811", "+", 34695, 36, 1, 1, "ACTCAGCCGTAAATCGAACCAATGAGGTCAGAGTAG"],
					["536574" , "-", 34835, 36, 1, 1, "GTCAGTAACGACCTCAACCTTGACGTTGTCAACTCT"]
				]
			}
		}